Targetprofiler recognises tha standard FASTA format when uploading a file with genomic coordinates or a sequence.
Due to server overload Tragetprofiler is limited to a single gene sequence up to 1000bp.
Example File 1: Coordinates file
Chromosome Start-Nucleotide End-Nucleotide Strand
----------start of file----------
>GeneID_1
1 100261124 100269040 -1
----------end of file----------

Example File 2: Sequence file

----------start of file----------
>GeneID_1
UCGUCUUUACUUCCAUCUGUUUGUUUUUUUCUCCAUCAGUGGGGGCCGAGUUGUUCCCCCAGCCUGCCAAAUUUUGAUCCUUCCCCUCUUUUGGCCAAAUCCUAG
----------end of file----------