MatureBayes

A banner image related to miRNA

A tool for finding mature miRNA within a miRNA precursor sequence using a Naive Bayes classifier.

How to cite us:
When you use MatureBayes in your research, please cite our paper: Gkirtzou K, Tsamardinos I, Tsakalides P, Poirazi P. MatureBayes: a probabilistic algorithm for identifying the mature miRNA within novel precursors. PLoS One. 2010 Aug 6;5(8):e11843. doi: 10.1371/journal.pone.0011843; PMID: 20700506; PMCID: PMC2917354
Example: 
UACAAUCCAACGAGGAUUCUAAUUUCUCCACGUCUUUGGUAAUAAGGUUUGGCAAAGAUGUGGAAAAAUUGGAAUCCUCAUUCGAUUGGUUAUAACCA

Use a simple text format where each sequence occupies two lines:

  • Line 1: The header, which must start with `>` (e.g., `>name and ID`).
  • Line 2: The raw sequence data on the next line.

Input Example for a single entry:

>hsa-mir-576 MI0003583
UACAAUCCAACGAGGAUUCUAAUUUCUCCACGUCUUUGGUAAUAAGGUUUGGCAAAGAUGUGGAAAAAUUGGAAUCCUCAUUCGAUUGGUUAUAACCA

For a file with multiple sequences, you would repeat this two-line block for each entry.