MatureBayes


A tool for finding mature miRNA within a miRNA precursor sequence using a Naive Bays classifier.

Paste the sequence of a single miRNA precursor:

Example ::
UACAAUCCAACGAGGAUUCUAAUUUCUCCACGUCUUUGGUAAUAAGGUUUGGCAAAGAUGUGGAAAAAUUGGAAUCCUCAUUCGAUUGGUUAUAACCA
OR
uacaauccaaugagguucuaauuucuccacgucuuugguaauaagguuuggcaaagauguggaaaaauuggaauccucauucgauugguuauaacca





Submit a file with multiple sequences in the following format:

Simple text format where each sequence occupies two lines. The first line has the form :
> name
where name is information assing to the sequence and the second line is the actual sequence.

Input Example ::
>hsa-mir-576 MI0003583
UACAAUCCAACGAGGAUUCUAAUUUCUCCACGUCUUUGGUAAUAAGGUUUGGCAAAGAUGUGGAAAAAUUGGAAUCCUCAUUCGAUUGGUUAUAACCA
>hsa-mir-194-2 MI0000732
UGGUUCCCGCCCCCUGUAACAGCAACUCCAUGUGGAAGUGCCCACUGGUUCCAGUGGGGCUGCUGUUAUCUGGGGCGAGGGCCAG


Download the source code (tar.gz, 4,04 MB)